Review



bbsi hf  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs bbsi hf
    Bbsi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 626 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/pm42129570-619-31-32
    Average 99 stars, based on 626 article reviews
    bbsi hf - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Endogenous short enhancer sequences increase expression of soybean and cowpea RUBP regeneration genes
    Article Snippet: Promoter constructs were generated by first amplifying genomic DNA via regular PCR and then introducing different sequences via overhang PCR using VeriFi® Hot Start Mix (PCR biosystems) or Q5® High-Fidelity DNA Polymerase (NEB)(see Supporting Data S 1 for a list of all used primers). .. The custom level 2 double fluorophore vector was generated by assembling a lacZ fragment, a fragment containing the EYFP coding sequence and an HSPt-terminator together with a fragment containing a p35S-promoter, the coding sequence of mRFP1 and a NOSt-terminator, together with a linker into pAGM4723 via Golden Gate cloning using BbsI-HF® (NEB) and T4 DNA ligase (NEB), according to previously published protocols [ , ]. .. The fragments originally derived from pICH47732, pICSL80014, EC15320 and pICH41766 and the mRFP1 expression cassette was ordered from Twist Biosciences (Twist Biosciences).

    Article Title: Developmental gene expression patterns driving species-specific cortical features.
    Article Snippet: Addgene #29687 pCS2-Flag-JUNB was used for JUNB overexpression experiments. .. Addgene #175573 pX458-Ef1adCas9-KRAB-MECP2-H2B-GFP (CRISPRi) was modified by replacing the Ef1a promoter with CAG using NEB HiFi DNA assembly reaction (NEB: E2621S). pCAG-CRISPRi plasmid generated in this study was then digested with BbsI-HF (NEB: R3539S) and using NEB HiFi DNA assembly, gRNA1: GAGGCCAGCCTCGGAGCCAGC and gRNA2: GCCAGCTCCCT GCTGGCTCCG was cloned into the backbone. pCAG-CRISPRi without a gRNA was used as a control. .. Addgene #153520 tFucci(SA)5 was used for cell cycle phase analysis experiments. pCAG-IRF1 (human), pCAG-Irf1 (mouse) and pCAG-TagBFP2-NLS were cloned by ordering IDT gBlocks of ensembl human IRF1 (IRF1-201), mouse Irf1 (Irf1-201) coding sequences, and TagBFP2 (ref. 74) fused with NLS domain75. pCAG-Cre (Addgene #13775) was digested with EcoRI and NotI and replaced with either of the Irf1/IRF1/TagBFP-NLS cDNA gBlocks using NEB HiFi DNA assembly reaction mix.

    Article Title: Chromatin dynamics of the Klf4 locus in mouse pluripotent cells.
    Article Snippet: Single stranded oligos containing the target sequence with a 5’ CACC overhang and the reverse complement of the target sequence with a 5’ AAAC overhang were annealed in 1X NEB Buffer 2.1 (New England Biolabs, Catalog no: B7202S) by heating up the sample to 95°C for 5 minutes and ramp down the temperature to 25°C by 5°C per minute in a thermocycler (final concentration 10 μM). .. To insert the target sequence in the plasmid backbones, PX459 V2.0 and B-SpCas9-HF1-2A-PuroR were digested with 1 μl BbsI-HF (New England Biolabs, Catalog no: R3539L) at 37°C O/N. .. The digested plasmid was purified via agarose gel electrophoresis followed by a spin column clean up using the Monarch DNA Gel Extraction Kit (New England Biolabs, Catalog no: T1020S) according to manufacturer’s instructions.

    Generated:

    Article Title: Endogenous short enhancer sequences increase expression of soybean and cowpea RUBP regeneration genes
    Article Snippet: Promoter constructs were generated by first amplifying genomic DNA via regular PCR and then introducing different sequences via overhang PCR using VeriFi® Hot Start Mix (PCR biosystems) or Q5® High-Fidelity DNA Polymerase (NEB)(see Supporting Data S 1 for a list of all used primers). .. The custom level 2 double fluorophore vector was generated by assembling a lacZ fragment, a fragment containing the EYFP coding sequence and an HSPt-terminator together with a fragment containing a p35S-promoter, the coding sequence of mRFP1 and a NOSt-terminator, together with a linker into pAGM4723 via Golden Gate cloning using BbsI-HF® (NEB) and T4 DNA ligase (NEB), according to previously published protocols [ , ]. .. The fragments originally derived from pICH47732, pICSL80014, EC15320 and pICH41766 and the mRFP1 expression cassette was ordered from Twist Biosciences (Twist Biosciences).

    Article Title: Developmental gene expression patterns driving species-specific cortical features.
    Article Snippet: Addgene #29687 pCS2-Flag-JUNB was used for JUNB overexpression experiments. .. Addgene #175573 pX458-Ef1adCas9-KRAB-MECP2-H2B-GFP (CRISPRi) was modified by replacing the Ef1a promoter with CAG using NEB HiFi DNA assembly reaction (NEB: E2621S). pCAG-CRISPRi plasmid generated in this study was then digested with BbsI-HF (NEB: R3539S) and using NEB HiFi DNA assembly, gRNA1: GAGGCCAGCCTCGGAGCCAGC and gRNA2: GCCAGCTCCCT GCTGGCTCCG was cloned into the backbone. pCAG-CRISPRi without a gRNA was used as a control. .. Addgene #153520 tFucci(SA)5 was used for cell cycle phase analysis experiments. pCAG-IRF1 (human), pCAG-Irf1 (mouse) and pCAG-TagBFP2-NLS were cloned by ordering IDT gBlocks of ensembl human IRF1 (IRF1-201), mouse Irf1 (Irf1-201) coding sequences, and TagBFP2 (ref. 74) fused with NLS domain75. pCAG-Cre (Addgene #13775) was digested with EcoRI and NotI and replaced with either of the Irf1/IRF1/TagBFP-NLS cDNA gBlocks using NEB HiFi DNA assembly reaction mix.

    Sequencing:

    Article Title: Endogenous short enhancer sequences increase expression of soybean and cowpea RUBP regeneration genes
    Article Snippet: Promoter constructs were generated by first amplifying genomic DNA via regular PCR and then introducing different sequences via overhang PCR using VeriFi® Hot Start Mix (PCR biosystems) or Q5® High-Fidelity DNA Polymerase (NEB)(see Supporting Data S 1 for a list of all used primers). .. The custom level 2 double fluorophore vector was generated by assembling a lacZ fragment, a fragment containing the EYFP coding sequence and an HSPt-terminator together with a fragment containing a p35S-promoter, the coding sequence of mRFP1 and a NOSt-terminator, together with a linker into pAGM4723 via Golden Gate cloning using BbsI-HF® (NEB) and T4 DNA ligase (NEB), according to previously published protocols [ , ]. .. The fragments originally derived from pICH47732, pICSL80014, EC15320 and pICH41766 and the mRFP1 expression cassette was ordered from Twist Biosciences (Twist Biosciences).

    Article Title: Chromatin dynamics of the Klf4 locus in mouse pluripotent cells.
    Article Snippet: Single stranded oligos containing the target sequence with a 5’ CACC overhang and the reverse complement of the target sequence with a 5’ AAAC overhang were annealed in 1X NEB Buffer 2.1 (New England Biolabs, Catalog no: B7202S) by heating up the sample to 95°C for 5 minutes and ramp down the temperature to 25°C by 5°C per minute in a thermocycler (final concentration 10 μM). .. To insert the target sequence in the plasmid backbones, PX459 V2.0 and B-SpCas9-HF1-2A-PuroR were digested with 1 μl BbsI-HF (New England Biolabs, Catalog no: R3539L) at 37°C O/N. .. The digested plasmid was purified via agarose gel electrophoresis followed by a spin column clean up using the Monarch DNA Gel Extraction Kit (New England Biolabs, Catalog no: T1020S) according to manufacturer’s instructions.

    Cloning:

    Article Title: Endogenous short enhancer sequences increase expression of soybean and cowpea RUBP regeneration genes
    Article Snippet: Promoter constructs were generated by first amplifying genomic DNA via regular PCR and then introducing different sequences via overhang PCR using VeriFi® Hot Start Mix (PCR biosystems) or Q5® High-Fidelity DNA Polymerase (NEB)(see Supporting Data S 1 for a list of all used primers). .. The custom level 2 double fluorophore vector was generated by assembling a lacZ fragment, a fragment containing the EYFP coding sequence and an HSPt-terminator together with a fragment containing a p35S-promoter, the coding sequence of mRFP1 and a NOSt-terminator, together with a linker into pAGM4723 via Golden Gate cloning using BbsI-HF® (NEB) and T4 DNA ligase (NEB), according to previously published protocols [ , ]. .. The fragments originally derived from pICH47732, pICSL80014, EC15320 and pICH41766 and the mRFP1 expression cassette was ordered from Twist Biosciences (Twist Biosciences).

    Article Title: Massively parallel characterization and deep learning of enhancers in plant genomes
    Article Snippet: The plasmids were deposited at Addgene (Addgene no. 256230 and 256231; https://www.addgene.org/256230/ ; https://www.addgene.org/256231/ ). .. The CaMV 35S minimal promoter (−46 to +5 relative to the 35S transcription start site) followed by the 5′ UTR from a maize histone H3 gene (Zm00001d041672) and an 18-bp random barcode (VNNVNNVNNVNNVNNVNN; V = A, C, or G) downstream of an ATG start codon was cloned in front of the second codon of GFP by Golden Gate cloning using BbsI-HF (NEB). ..

    Clone Assay:

    Article Title: Massively parallel characterization and deep learning of enhancers in plant genomes
    Article Snippet: The plasmids were deposited at Addgene (Addgene no. 256230 and 256231; https://www.addgene.org/256230/ ; https://www.addgene.org/256231/ ). .. The CaMV 35S minimal promoter (−46 to +5 relative to the 35S transcription start site) followed by the 5′ UTR from a maize histone H3 gene (Zm00001d041672) and an 18-bp random barcode (VNNVNNVNNVNNVNNVNN; V = A, C, or G) downstream of an ATG start codon was cloned in front of the second codon of GFP by Golden Gate cloning using BbsI-HF (NEB). ..

    Article Title: Cis-regulatory architecture downstream of FLOWERING LOCUS T underlies quantitative control of flowering in Arabidopsis thaliana
    Article Snippet: .. In brief, sgRNAs were designed with CRISPR-P 2.0 [ ], annealed oligonucleotides were assembled into shuttle vectors via simultaneous restriction/ligation with BbsI-HF (NEB), and subsequently cloned into the dicot genome-editing recipient vector pDGE347 by Golden Gate assembly with BsaI-HF (NEB). ..

    Article Title: Developmental gene expression patterns driving species-specific cortical features.
    Article Snippet: Addgene #29687 pCS2-Flag-JUNB was used for JUNB overexpression experiments. .. Addgene #175573 pX458-Ef1adCas9-KRAB-MECP2-H2B-GFP (CRISPRi) was modified by replacing the Ef1a promoter with CAG using NEB HiFi DNA assembly reaction (NEB: E2621S). pCAG-CRISPRi plasmid generated in this study was then digested with BbsI-HF (NEB: R3539S) and using NEB HiFi DNA assembly, gRNA1: GAGGCCAGCCTCGGAGCCAGC and gRNA2: GCCAGCTCCCT GCTGGCTCCG was cloned into the backbone. pCAG-CRISPRi without a gRNA was used as a control. .. Addgene #153520 tFucci(SA)5 was used for cell cycle phase analysis experiments. pCAG-IRF1 (human), pCAG-Irf1 (mouse) and pCAG-TagBFP2-NLS were cloned by ordering IDT gBlocks of ensembl human IRF1 (IRF1-201), mouse Irf1 (Irf1-201) coding sequences, and TagBFP2 (ref. 74) fused with NLS domain75. pCAG-Cre (Addgene #13775) was digested with EcoRI and NotI and replaced with either of the Irf1/IRF1/TagBFP-NLS cDNA gBlocks using NEB HiFi DNA assembly reaction mix.

    Article Title: Cis-regulatory architecture downstream of FLOWERING LOCUS T underlies quantitative control of flowering in Arabidopsis thaliana.
    Article Snippet: .. In brief, sgRNAs were designed with CRISPR-P 2.0 [49], annealed oligonucleotides were assembled into shuttle vectors via simultaneous restriction/ligation with BbsI-HF (NEB), and subsequently cloned into the dicot genome-editing recipient vector pDGE347 by Golden Gate assembly with BsaI-HF (NEB). ..

    CRISPR:

    Article Title: Cis-regulatory architecture downstream of FLOWERING LOCUS T underlies quantitative control of flowering in Arabidopsis thaliana
    Article Snippet: .. In brief, sgRNAs were designed with CRISPR-P 2.0 [ ], annealed oligonucleotides were assembled into shuttle vectors via simultaneous restriction/ligation with BbsI-HF (NEB), and subsequently cloned into the dicot genome-editing recipient vector pDGE347 by Golden Gate assembly with BsaI-HF (NEB). ..

    Article Title: Cis-regulatory architecture downstream of FLOWERING LOCUS T underlies quantitative control of flowering in Arabidopsis thaliana.
    Article Snippet: .. In brief, sgRNAs were designed with CRISPR-P 2.0 [49], annealed oligonucleotides were assembled into shuttle vectors via simultaneous restriction/ligation with BbsI-HF (NEB), and subsequently cloned into the dicot genome-editing recipient vector pDGE347 by Golden Gate assembly with BsaI-HF (NEB). ..

    Modification:

    Article Title: Developmental gene expression patterns driving species-specific cortical features.
    Article Snippet: Addgene #29687 pCS2-Flag-JUNB was used for JUNB overexpression experiments. .. Addgene #175573 pX458-Ef1adCas9-KRAB-MECP2-H2B-GFP (CRISPRi) was modified by replacing the Ef1a promoter with CAG using NEB HiFi DNA assembly reaction (NEB: E2621S). pCAG-CRISPRi plasmid generated in this study was then digested with BbsI-HF (NEB: R3539S) and using NEB HiFi DNA assembly, gRNA1: GAGGCCAGCCTCGGAGCCAGC and gRNA2: GCCAGCTCCCT GCTGGCTCCG was cloned into the backbone. pCAG-CRISPRi without a gRNA was used as a control. .. Addgene #153520 tFucci(SA)5 was used for cell cycle phase analysis experiments. pCAG-IRF1 (human), pCAG-Irf1 (mouse) and pCAG-TagBFP2-NLS were cloned by ordering IDT gBlocks of ensembl human IRF1 (IRF1-201), mouse Irf1 (Irf1-201) coding sequences, and TagBFP2 (ref. 74) fused with NLS domain75. pCAG-Cre (Addgene #13775) was digested with EcoRI and NotI and replaced with either of the Irf1/IRF1/TagBFP-NLS cDNA gBlocks using NEB HiFi DNA assembly reaction mix.

    Control:

    Article Title: Developmental gene expression patterns driving species-specific cortical features.
    Article Snippet: Addgene #29687 pCS2-Flag-JUNB was used for JUNB overexpression experiments. .. Addgene #175573 pX458-Ef1adCas9-KRAB-MECP2-H2B-GFP (CRISPRi) was modified by replacing the Ef1a promoter with CAG using NEB HiFi DNA assembly reaction (NEB: E2621S). pCAG-CRISPRi plasmid generated in this study was then digested with BbsI-HF (NEB: R3539S) and using NEB HiFi DNA assembly, gRNA1: GAGGCCAGCCTCGGAGCCAGC and gRNA2: GCCAGCTCCCT GCTGGCTCCG was cloned into the backbone. pCAG-CRISPRi without a gRNA was used as a control. .. Addgene #153520 tFucci(SA)5 was used for cell cycle phase analysis experiments. pCAG-IRF1 (human), pCAG-Irf1 (mouse) and pCAG-TagBFP2-NLS were cloned by ordering IDT gBlocks of ensembl human IRF1 (IRF1-201), mouse Irf1 (Irf1-201) coding sequences, and TagBFP2 (ref. 74) fused with NLS domain75. pCAG-Cre (Addgene #13775) was digested with EcoRI and NotI and replaced with either of the Irf1/IRF1/TagBFP-NLS cDNA gBlocks using NEB HiFi DNA assembly reaction mix.



    Similar Products

    99
    New England Biolabs bbsi hf
    Bbsi Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/pm42129570-619-31-32
    Average 99 stars, based on 1 article reviews
    bbsi hf - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs bbsi
    Bbsi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/pm42103732-181-43-44
    Average 99 stars, based on 1 article reviews
    bbsi - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs r3539s t4 dna ligase neb
    R3539s T4 Dna Ligase Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/pm42102812-772-151-155
    Average 99 stars, based on 1 article reviews
    r3539s t4 dna ligase neb - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs tggttacaggagggctcggca reverse translated epitope
    Tggttacaggagggctcggca Reverse Translated Epitope, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/bio_rxiv__64898__2026__04__29__720676-150-13-18
    Average 99 stars, based on 1 article reviews
    tggttacaggagggctcggca reverse translated epitope - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs golden gate assembly
    Golden Gate Assembly, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/bio_rxiv__64898__2026__04__29__721476-127-9-13
    Average 99 stars, based on 1 article reviews
    golden gate assembly - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs bbs i hf
    Bbs I Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/pmc13130651-34-0-3
    Average 99 stars, based on 1 article reviews
    bbs i hf - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs r3539m
    R3539m, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+hf/BbsI-HF/pmc13130651-34-6-3
    Average 99 stars, based on 1 article reviews
    r3539m - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results